Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5149590
End position: 5149619
Length: 30

DNA sequence
>NC_009142, from 5149590 to 5149619 (30 bp); Saccharopolyspora erythraea NRRL 2338 GCCGTCGCGCGCCCGCGCGCACCGACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5149025-5149888	Sequence	SACE_4604 dapA dihydrodipicolinate synthase (Protein is coded in complementary strand; from 5149888 to 5149025)