Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7139598
End position: 7139627
Length: 30

DNA sequence
>NC_009142, from 7139598 to 7139627 (30 bp); Saccharopolyspora erythraea NRRL 2338 CCGGGCCAACCCGGGCTGACCCGGGTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 7138298-7139617	Sequence	SACE_6372 - long chain fatty acid CoA ligase