Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7481608
End position: 7481637
Length: 30

DNA sequence
>NC_009142, from 7481608 to 7481637 (30 bp); Saccharopolyspora erythraea NRRL 2338 CGTCGGCGTCCGCCTCGGAGTCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7479822-7482443	Sequence	SACE_6681 uvrD ATP-dependent DNA helicase (Protein is coded in complementary strand; from 7482443 to 7479822)