Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7599285
End position: 7599314
Length: 30

DNA sequence
>NC_009142, from 7599285 to 7599314 (30 bp); Saccharopolyspora erythraea NRRL 2338 AGCATCATCATCGGCATCATCATCATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7595433-7599512	Sequence	SACE_6792 - cell division FtsK/SpoIIIE (Protein is coded in complementary strand; from 7599512 to 7595433)