Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7963645
End position: 7963674
Length: 30

DNA sequence
>NC_009142, from 7963645 to 7963674 (30 bp); Saccharopolyspora erythraea NRRL 2338 CGGGCGGCTCCGCGCGGGTCCGGGTCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7963621-7964202	Sequence	SACE_7158 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 7964202 to 7963621)