Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 881424
End position: 881453
Length: 30

DNA sequence
>NC_009142, from 881424 to 881453 (30 bp); Saccharopolyspora erythraea NRRL 2338 GGTCGGCCGGGGTCGGCGGACGTCGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 880141-881463	Sequence	SACE_0788 - two-component system sensor kinase (Protein is coded in complementary strand; from 881463 to 880141)