Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1119012
End position: 1119047
Length: 36

DNA sequence
>NC_009142, from 1119012 to 1119047 (36 bp); Saccharopolyspora erythraea NRRL 2338 GGCGGCCTTCTTCCCGGCCTTCTTCGCGGCCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1118944-1119327	Sequence	SACE_1004 - hypothetical protein (Protein is coded in complementary strand; from 1119327 to 1118944)