Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 127306
End position: 127341
Length: 36

DNA sequence
>NC_009142, from 127306 to 127341 (36 bp); Saccharopolyspora erythraea NRRL 2338 GTCGTCATGGTCGGCGTCGTGGTCGTCGTCATCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 125860-127314	Sequence	SACE_0102 - two component sensor kinase (Protein is coded in complementary strand; from 127314 to 125860)
ORF. 127304-127558	Sequence	SACE_0103 - hypothetical protein (Protein is coded in complementary strand; from 127558 to 127304)