Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4253242
End position: 4253277
Length: 36

DNA sequence
>NC_009142, from 4253242 to 4253277 (36 bp); Saccharopolyspora erythraea NRRL 2338 GTCCTCGACGGGGTGCTCGACGGCGTCGTCGACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4252847-4253794	Sequence	SACE_3883 - LysR family transcriptional regulator