Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4846054
End position: 4846089
Length: 36

DNA sequence
>NC_009142, from 4846054 to 4846089 (36 bp); Saccharopolyspora erythraea NRRL 2338 TCCACGGCGCCTTCCCGGGCGCCTTCCACCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4845370-4846107	Sequence	SACE_4323 - short chain dehydrogenase/reductase oxidoreductase