Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7848735
End position: 7848770
Length: 36

DNA sequence
>NC_009142, from 7848735 to 7848770 (36 bp); Saccharopolyspora erythraea NRRL 2338 CGAGCTCGGCGTCGAGGTCGGCGACGAGCTTGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7847228-7848841	Sequence	SACE_7039 accD1 propionyl-CoA carboxylase subunit beta (Protein is coded in complementary strand; from 7848841 to 7847228)