Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1151657
End position: 1151701
Length: 45

DNA sequence
>NC_009142, from 1151657 to 1151701 (45 bp); Saccharopolyspora erythraea NRRL 2338 TGTGCCGTTGCGGGCTGAGCCGTCGTGGGCTGCGCCGTCGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1151609-1152337	Sequence	SACE_1036 - hypothetical protein (Protein is coded in complementary strand; from 1152337 to 1151609)