Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1465107
End position: 1465151
Length: 45

DNA sequence
>NC_009142, from 1465107 to 1465151 (45 bp); Saccharopolyspora erythraea NRRL 2338 GAGTCCGCGGGCTCCGATCTCGCGGGCTCCGAGTTCGCGAGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1461784-1466475	Sequence	SACE_1324 - cell wall surface anchor family protein