Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2588448
End position: 2588492
Length: 45

DNA sequence
>NC_009142, from 2588448 to 2588492 (45 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGGGTTCGGCGGCGGCGGGCTCGCGGGCGGCGAGTTCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2588357-2589370	Sequence	SACE_2385 - ATP-dependent protease (Protein is coded in complementary strand; from 2589370 to 2588357)