Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3339186
End position: 3339230
Length: 45

DNA sequence
>NC_009142, from 3339186 to 3339230 (45 bp); Saccharopolyspora erythraea NRRL 2338 GCCGGGCTCTCCGGCGCCGGTCTCGCCGACGCCGAGCGCCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3328675-3344964	Sequence	SACE_3035 - non-ribosomal peptide synthetase