Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6135581
End position: 6135625
Length: 45

DNA sequence
>NC_009142, from 6135581 to 6135625 (45 bp); Saccharopolyspora erythraea NRRL 2338 CCTCCGCAAGCTGCCGCTCGGCAAGCGGCCGCTCAGCAAGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6119581-6144759	Sequence	SACE_5463 - hypothetical protein (Protein is coded in complementary strand; from 6144759 to 6119581)