Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6284768
End position: 6284812
Length: 45

DNA sequence
>NC_009142, from 6284768 to 6284812 (45 bp); Saccharopolyspora erythraea NRRL 2338 CCGCCGTGGCCCTCCCCGCCGTGGCCCTCGCCACCGTGCGCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6284711-6285868	Sequence	SACE_5588 - hypothetical protein (Protein is coded in complementary strand; from 6285868 to 6284711)