Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6653595
End position: 6653639
Length: 45

DNA sequence
>NC_009142, from 6653595 to 6653639 (45 bp); Saccharopolyspora erythraea NRRL 2338 CCGCTCGGAGCGCGGCTGCTCGGAGCGCGGCTGCTCGGAGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6651019-6654102	Sequence	SACE_5926 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 6654102 to 6651019)