Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6697129
End position: 6697173
Length: 45

DNA sequence
>NC_009142, from 6697129 to 6697173 (45 bp); Saccharopolyspora erythraea NRRL 2338 GCCGTCCGGGCCGTCGCCGTCAGGACCGTTCCCGTCGGGGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6696206-6698356	Sequence	SACE_5965 chlI magnesium-chelatase subunit (Protein is coded in complementary strand; from 6698356 to 6696206)