Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7671784
End position: 7671828
Length: 45

DNA sequence
>NC_009142, from 7671784 to 7671828 (45 bp); Saccharopolyspora erythraea NRRL 2338 GCATCGTCGGACGCGGCGTCGTCGGGCTCGACATCGTCGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7671124-7672119	Sequence	SACE_6856 - hypothetical protein (Protein is coded in complementary strand; from 7672119 to 7671124)