Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3584294
End position: 3584347
Length: 54

DNA sequence
>NC_009142, from 3584294 to 3584347 (54 bp); Saccharopolyspora erythraea NRRL 2338 CCAGAACGCGGCTGACACCCAGAACGCGGCTGACGCCCGGAACGCGGCTGACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3582706-3584355	Sequence	SACE_3239 slpD proteinase (Protein is coded in complementary strand; from 3584355 to 3582706)