Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6563698
End position: 6563751
Length: 54

DNA sequence
>NC_009142, from 6563698 to 6563751 (54 bp); Saccharopolyspora erythraea NRRL 2338 GTAGTGCGCCCCTACTGCGCAGTGCGGCCCTACGGCTTGGTGCGCCCCTACTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 6563469-6563702	Sequence	SACE_5848 - hypothetical protein
ORF... 6563746-6564429	Sequence	SACE_5849 ftsQ cell division protein (Protein is coded in complementary strand; from 6564429 to 6563746)