Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7896919
End position: 7896972
Length: 54

DNA sequence
>NC_009142, from 7896919 to 7896972 (54 bp); Saccharopolyspora erythraea NRRL 2338 CCTTCCGCACCTCCCGGGCCTTCCGGATCTTCCGGGCCTTCCGCACCTCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7896809-7899055	Sequence	SACE_7090 - LytR family transcriptional regulator