Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4978095
End position: 4978154
Length: 60

DNA sequence
>NC_009142, from 4978095 to 4978154 (60 bp); Saccharopolyspora erythraea NRRL 2338 CCTGCTCGTTGGCGTCCTGCTCGTTGGCGTCCTGCTCGTTGGCGTCCTGCTCGTTGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4977524-4978399	Sequence	SACE_4451 - hypothetical protein (Protein is coded in complementary strand; from 4978399 to 4977524)