Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7641608
End position: 7641667
Length: 60

DNA sequence
>NC_009142, from 7641608 to 7641667 (60 bp); Saccharopolyspora erythraea NRRL 2338 TCATCCGCGAGCGGTTCATCCGCGCGCAGCTCATCGGCACGCGGTTCATCCGCGAGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7639658-7643758	Sequence	SACE_6844 - hypothetical protein (Protein is coded in complementary strand; from 7643758 to 7639658)