Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7286751
End position: 7286813
Length: 63

DNA sequence
>NC_009142, from 7286751 to 7286813 (63 bp); Saccharopolyspora erythraea NRRL 2338 CCCTGCCCATCGGCCGCCTGACCAACCCCATCGGCAGCCTGACCCAGCCCGTCGGCGGCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7285278-7287680	Sequence	SACE_6494 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 7287680 to 7285278)