Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 2187302
End position: 2187325
Length: 24

DNA sequence
>NC_009342, from 2187302 to 2187325 (24 bp); Corynebacterium glutamicum R AAGATTCAGATTCAGATTCAGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2186857-2187513	Sequence	cgR_1989 - hypothetical protein (Protein is coded in complementary strand; from 2187513 to 2186857)