Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 60938
End position: 60961
Length: 24

DNA sequence
>NC_009342, from 60938 to 60961 (24 bp); Corynebacterium glutamicum R CAGACCCAGATCCAGACCCTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 59980-61932	Sequence	cgR_0054 - hypothetical protein (Protein is coded in complementary strand; from 61932 to 59980)