Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 2403390
End position: 2403416
Length: 27

DNA sequence
>NC_009342, from 2403390 to 2403416 (27 bp); Corynebacterium glutamicum R ATGGGCATCATGGGCATCATCGGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403246-2405051	Sequence	cgR_2178 - hypothetical protein (Protein is coded in complementary strand; from 2405051 to 2403246)