Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 2646034
End position: 2646060
Length: 27

DNA sequence
>NC_009342, from 2646034 to 2646060 (27 bp); Corynebacterium glutamicum R GCTGGGGTTGCTGGGGTTGCTGGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2642143-2651133	Sequence	cgR_2406 - hypothetical protein (Protein is coded in complementary strand; from 2651133 to 2642143)