Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 3297604
End position: 3297630
Length: 27

DNA sequence
>NC_009342, from 3297604 to 3297630 (27 bp); Corynebacterium glutamicum R CAAAACAGCCAAAACAACCAGAACAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3297311-3298279	Sequence	cgR_2975 - hypothetical protein
ORF. 3297386-3297655	Sequence	cgR_2976 - hypothetical protein (Protein is coded in complementary strand; from 3297655 to 3297386)