Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 460495
End position: 460521
Length: 27

DNA sequence
>NC_009342, from 460495 to 460521 (27 bp); Corynebacterium glutamicum R CAGAAGCCCCAGAAGCCCCAGAAACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 459474-460736	Sequence	cgR_0421 - hypothetical protein (Protein is coded in complementary strand; from 460736 to 459474)