Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 725432
End position: 725458
Length: 27

DNA sequence
>NC_009342, from 725432 to 725458 (27 bp); Corynebacterium glutamicum R TGGGAAGTCTGGGAAGTCTGGGAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 724166-725461	Sequence	cgR_0666 - hypothetical protein (Protein is coded in complementary strand; from 725461 to 724166)