Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 54157
End position: 54186
Length: 30

DNA sequence
>NC_009342, from 54157 to 54186 (30 bp); Corynebacterium glutamicum R CAGCCTCAGCCACAACCTCAGGCTCATCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 53895-54725	Sequence	cgR_0047 - hypothetical protein (Protein is coded in complementary strand; from 54725 to 53895)