Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 229729
End position: 229761
Length: 33

DNA sequence
>NC_009342, from 229729 to 229761 (33 bp); Corynebacterium glutamicum R ATCGGAAGCGAATCGGAAGTTAATCGGACTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 229749-230630	Sequence	cgR_0211 - hypothetical protein (Protein is coded in complementary strand; from 230630 to 229749)