Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 1395261
End position: 1395296
Length: 36

DNA sequence
>NC_009342, from 1395261 to 1395296 (36 bp); Corynebacterium glutamicum R CTTTTCAGAAGACTGTTCAGAAGACTTCCCAGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1391554-1395312	Sequence	cgR_1268 - hypothetical protein (Protein is coded in complementary strand; from 1395312 to 1391554)