Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 2014991
End position: 2015026
Length: 36

DNA sequence
>NC_009342, from 2014991 to 2015026 (36 bp); Corynebacterium glutamicum R CTGACCATCACGCTGTCCGTCACGCTGACCATCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2012742-2015753	Sequence	cgR_1814 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 2015753 to 2012742)