Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 1766933
End position: 1766977
Length: 45

DNA sequence
>NC_009342, from 1766933 to 1766977 (45 bp); Corynebacterium glutamicum R GCTTGCGCTGCCTGAGCTTGCGCGGCTTGTGCTTGTGCTGTCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1766147-1767979	Sequence	cgR_1596 - hypothetical protein (Protein is coded in complementary strand; from 1767979 to 1766147)