Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 2641807
End position: 2641851
Length: 45

DNA sequence
>NC_009342, from 2641807 to 2641851 (45 bp); Corynebacterium glutamicum R GTGGGATTGCTCGAGGTGGAATCGCTGGAGGTGGGATTGCTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2640403-2641860	Sequence	cgR_2405 - hypothetical protein (Protein is coded in complementary strand; from 2641860 to 2640403)