Sequence retrieval

Genome: Corynebacterium glutamicum R
Start position: 686643
End position: 686690
Length: 48

DNA sequence
>NC_009342, from 686643 to 686690 (48 bp); Corynebacterium glutamicum R CGAGATTCTGGGCGAGATTCTGGGCGAGATTCTGGGCGAGATTCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 686078-687019	Sequence	cgR_0626 - formate dehydrogenase accessory protein (Protein is coded in complementary strand; from 687019 to 686078)