Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 1115911
End position: 1115937
Length: 27

DNA sequence
>NC_009348, from 1115911 to 1115937 (27 bp); Aeromonas salmonicida subsp. salmonicida A449 AAGAAGCACAAAAAGCACAAGAAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1115567-1115959	Sequence	ASA_1083 - surface antigen family protein