Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 1375962
End position: 1376015
Length: 54

DNA sequence
>NC_009348, from 1375962 to 1376015 (54 bp); Aeromonas salmonicida subsp. salmonicida A449 CTGCTGATCCTGCTGATCCTGCTGATCCTGCTGATCCTGCTGATCCTGCTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1373389-1376499	Sequence	ASA_1319 acrD acriflavin resistance protein