Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 166595
End position: 166621
Length: 27

DNA sequence
>NC_009348, from 166595 to 166621 (27 bp); Aeromonas salmonicida subsp. salmonicida A449 CTGCCTGCTCAGCCTGCTCAGCCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 166543-167496	Sequence	ASA_0157 - glycosyl transferase family protein