Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 1777031
End position: 1777066
Length: 36

DNA sequence
>NC_009348, from 1777031 to 1777066 (36 bp); Aeromonas salmonicida subsp. salmonicida A449 TGTCTACCTTGGTCTCAACCTTGGCTTCTACCTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1777009-1779684	Sequence	ASA_1695 adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase (Protein is coded in complementary strand; from 1779684 to 1777009)