Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 2424350
End position: 2424397
Length: 48

DNA sequence
>NC_009348, from 2424350 to 2424397 (48 bp); Aeromonas salmonicida subsp. salmonicida A449 AAGCTGAGAAGTTGAGAAGTTGAGAAGTTGAGAAGTTGAGAAGTTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2422973-2424352	Sequence	ASA_2293 pabB para-aminobenzoate synthase, component I