Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 2624006
End position: 2624029
Length: 24

DNA sequence
>NC_009348, from 2624006 to 2624029 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 CCACCGCCAGCGCCAGCGACACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2622667-2624205	Sequence	ASA_2460 - type VI secretion system sigma-54 dependent transcriptional regulator (Protein is coded in complementary strand; from 2624205 to 2622667)