Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 2661702
End position: 2661728
Length: 27

DNA sequence
>NC_009348, from 2661702 to 2661728 (27 bp); Aeromonas salmonicida subsp. salmonicida A449 GCCAGCTCAGCAAGCTCAGCAAGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2660712-2662646	Sequence	ASA_2497 - GGDEF/EAL domain-containing protein (Protein is coded in complementary strand; from 2662646 to 2660712)