Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 2671177
End position: 2671200
Length: 24

DNA sequence
>NC_009348, from 2671177 to 2671200 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 TGCGCCTGGGCCTGGGCCTGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2671009-2672556	Sequence	ASA_2504 - TerC family integral membrane protein