Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 2685021
End position: 2685044
Length: 24

DNA sequence
>NC_009348, from 2685021 to 2685044 (24 bp); Aeromonas salmonicida subsp. salmonicida A449 CCAGCTCCTGCTCCTGCTCCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2684744-2685388	Sequence	ASA_2516 maiA maleylacetoacetate isomerase (Protein is coded in complementary strand; from 2685388 to 2684744)