Sequence retrieval

Genome: Aeromonas salmonicida subsp. salmonicida A449
Start position: 2957961
End position: 2958020
Length: 60

DNA sequence
>NC_009348, from 2957961 to 2958020 (60 bp); Aeromonas salmonicida subsp. salmonicida A449 CAGCCGGGCAGCGCATCGAGCAGCCGGGCAGCGCATCGAGCAGCCGGGCAGCGCATCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2957788-2958573	Sequence	ASA_2759 - alpha/beta fold family hydrolase (Protein is coded in complementary strand; from 2958573 to 2957788)